diff --git a/docs/en_us/course_authors/source/Images/GeneExplorer.png b/docs/en_us/course_authors/source/Images/GeneExplorer.png
new file mode 100644
index 0000000000..edeb255dd6
Binary files /dev/null and b/docs/en_us/course_authors/source/Images/GeneExplorer.png differ
diff --git a/docs/en_us/course_authors/source/additional_tools.rst b/docs/en_us/course_authors/source/additional_tools.rst
index 1abca76bc8..1be90aba7e 100644
--- a/docs/en_us/course_authors/source/additional_tools.rst
+++ b/docs/en_us/course_authors/source/additional_tools.rst
@@ -13,11 +13,75 @@ Individual course teams frequently create tools and problem types that don't hav
 
 Below, you'll find the information you need to create the following tools.
 
+* :ref:`Gene Explorer`
 * :ref:`Interactive Periodic Table`
 * :ref:`Molecule Editor`
 * :ref:`Multiple Choice and Numerical Input`
 * :ref:`Protein Builder`
 
+.. _Gene Explorer:
+
+**************************
+Gene Explorer
+**************************
+
+The Gene Explorer (GeneX), from the biology department at `UMB <http://www.umb.edu/>`_, simulates the transcription, splicing, processing, and translation of a small hypothetical eukaryotic gene. GeneX allows students to make specific mutations in a gene sequence, and it then calculates and displays the effects of the mutations on the mRNA and protein. 
+
+Specifically, the Gene Explorer does the following:
+
+#. Finds the promoter and terminator
+#. Reads the DNA sequence to produce the pre-mRNA
+#. Finds the splice sites
+#. Splices and tails the mRNA
+#. Finds the start codon
+#. Translates the mRNA
+
+.. image:: /Images/GeneExplorer.png
+  :alt: Image of the Gene Explorer
+
+For more information about the Gene Explorer, see `The Gene Explorer <http://intro.bio.umb.edu/GX/>`_.
+
+.. _Create the Gene Explorer:
+
+==========================
+Create the Gene Explorer
+==========================
+
+#. In the unit where you want to create the problem, click **Problem** under **Add New Component**, and then click the **Advanced** tab.
+#. Click **Blank Advanced Problem**.
+#. In the component that appears, click **Edit**.
+#. In the component editor, paste the code from below.
+#. Click **Save**.
+
+=====================
+Gene Explorer Code
+=====================
+
+::
+
+  <problem>
+  <p>Make a single base pair substitution mutation in the gene below that results in a protein that is longer than the protein produced by the original gene. When you are satisfied with your change and its effect, click the <b>SUBMIT</b> button.</p>
+  <p>Note that a "single base pair substitution mutation" is when a single base is changed to another base; for example, changing the A at position 80 to a T. Deletions and insertions are not allowed.</p>
+  <script type="loncapa/python">
+  def genex_grader(expect,ans):
+      if ans=="CORRECT": return True
+      import json
+      ans=json.loads(ans)
+      return ans["genex_answer"]=="CORRECT"
+  </script>
+  <customresponse cfn="genex_grader">
+  <editageneinput width="818" height="1000" dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_problem_number="2"/>
+  </customresponse>
+  </problem>
+
+In this code:
+
+* **width** and **height** specify the dimensions of the application, in pixels.
+* **genex_dna_sequence** is the default DNA sequence that appears when the problem opens.
+* **dna_sequence** contains the application's state and the student's answer. This value must be the same as **genex_dna_sequence**. 
+* **genex_problem_number** specifies the number of the problem. This number is based on the five gene editor problems in the MITx 7.00x course--for example, if you want this problem to look like the second gene editor problem in the 7.00x course, you would set the **genex_problem_number** value to 2. The number must be 1, 2, 3, 4, or 5.
+
+
 .. _Interactive Periodic Table:
 
 **************************
@@ -60,7 +124,9 @@ To create the periodic table, you need an HTML component.
 Molecule Editor
 ************************
 
-Students can use the molecule editor to learn how to create molecules. The molecule editor allows students to draw molecules that follow the rules for covalent bond formation and formal charge, but are chemically impossible. The molecule editor warns students if they try to submit a structure that is not possible.
+Students can use the molecule editor to learn how to create molecules. The molecule editor allows students to draw molecules that follow the rules for covalent bond formation and formal charge, even if the molecules are chemically impossible, are unstable, or do not exist in living systems. The molecule editor warns students if they try to submit a structure that is chemically impossible.
+
+The molecule editor incorporates two tools: the JSME molecule editor created by Peter Erl and Bruno Bienfait, and JSmol, a JavaScript-based molecular viewer from Jmol. (You don't need to download either of these tools--Studio uses them automatically.) For more information about the JSME molecule editor, see `JSME Molecule Editor <http://peter-ertl.com/jsme/index.html>`_. For more information about JSmol, see `JSmol <http://sourceforge.net/projects/jsmol/>`_.
 
 .. image:: /Images/Molecule_Editor.gif
   :alt: Image of the molecule editor
@@ -73,13 +139,15 @@ Create the Molecule Editor
 
 To create a molecule editor, you need the following files:
 
-* Molecules_Dopamine.mol
 * MoleculeAnswer.png
 * MoleculeEditor_HTML.png
+* dopamine.mol
 
 To download all of these files in a .zip archive, go to http://files.edx.org/MoleculeEditorFiles.zip.
 
-To create the molecule editor, you need an HTML component followed by a Problem component.
+.. note:: The molecule that appears when the tool starts is a dopamine molecule. To use a different molecule, download the .mol file for that molecule from the `list of molecules <http://www.biotopics.co.uk/jsmol/molecules/>`_ on the `BioTopics <http://www.biotopics.co.uk/>`_ website. Then, upload the .mol file to the **Files & Uploads** page for your course in Studio, and change "dopamine.mol" in the example code to the name of your .mol file.
+
+To create the molecule editor that appears in the image above, you need an HTML component followed by a Problem component.
 
 #. Upload all of the files listed above to the **Files & Uploads** page in your course.
 #. Create the HTML component.
@@ -99,7 +167,7 @@ To create the molecule editor, you need an HTML component followed by a Problem
 Molecule Editor Code
 =====================
 
-To create the molecule editor, you'll need an HTML component followed by a Problem component.
+To create the molecule editor, you need an HTML component and a Problem component.
 
 HTML Component Code
 -------------------
@@ -143,15 +211,15 @@ HTML Component Code
   <div id="IntroductionContent" style="display: none;">
   <p>The chemical editor you are using ensures that the structures you draw are correct in one very narrow sense, that they follow the rules for covalent bond formation and formal charge. However, there are many structures that follow these rules that are chemically impossible, unstable, do not exist in living systems, or are beyond the scope of this course. The editor will let you draw them because, in contrast to the rules of formal charge, these properties cannot be easily and reliably predicted from structures.</p>
   <p>If you submit a structure that includes atoms that are not possible or are beyond the scope of this course, the software will warn you specifically about these parts of your structure and you will be allowed to edit your structure and re-submit. Submitting an improper structure will not count as one of your tries. In general, you should try to use only the atoms most commonly cited in this course: C, H, N, O, P, and S. If you want to learn about formal charge, you can play around with other atoms and unusual configurations and look at the structures that result.</p>
-  <p>The JME molecular editor is provided courtesy of Peter Ertl and Novartis; the licence can be found <a href="/static/data/license.txt">here.</a></p>
   </div>
   </div>
   <div id="ap_listener_added">&nbsp;</div>
 
-
-
 Problem Component
 -----------------
+
+**Problem 1**
+
 ::
 
   <problem>
@@ -168,10 +236,49 @@ Problem Component
           </editamoleculeinput>
     </customresponse>
     <solution>
-      <img src="/static/Molecule.jpg"/>
+      <img src="/static/MoleculeAnswer.png"/>
     </solution>
   </problem>
 
+**Problem 2**
+
+::
+
+  <problem>
+  <p>The dopamine molecule, as shown, cannot make strong hydrogen bonds. Edit the dopamine molecule so that it can make strong hydrogen bonds.</p>
+  <script type="loncapa/python">
+  def grader_1(expect, ans):
+      import json
+      mol_info = json.loads(ans)["info"]
+      return any(res == "Cannot Make Strong Hydrogen Bonds" for res in mol_info)
+  </script>
+    <customresponse cfn="grader_1">
+      <editamoleculeinput file="/static/dopamine.mol">
+      </editamoleculeinput>
+    </customresponse>
+  </problem>
+
+**Problem 3**
+
+::
+
+  <problem>
+  <p>The dopamine molecule has an intermediate hydrophobicity. Edit the dopamine molecule so that it is more hydrophobic.</p>
+  <script type="loncapa/python">
+  def grader_2(expect, ans):
+      import json
+      mol_info = json.loads(ans)["info"]
+
+      hydrophobicity_index_str=mol_info[0]
+      hydrophobicity_index=float(hydrophobicity_index_str[23:])
+      return hydrophobicity_index &gt; .490
+  </script>
+    <customresponse cfn="grader_2">
+      <editamoleculeinput file="/static/dopamine.mol">
+      </editamoleculeinput>
+  </customresponse>
+  </problem>
+
 .. _Multiple Choice and Numerical Input:
 
 *******************************************
@@ -221,10 +328,10 @@ Multiple Choice and Numerical Input Problem Code
 .. _Protein Builder:
 
 ************************
-Protein Builder
+Protex Protein Builder
 ************************
 
-The protein builder asks students to create specified protein shapes by stringing together amino acids. In the example below, the goal protein shape is a simple line. 
+The Protex protein builder asks students to create specified protein shapes by stringing together amino acids. In the example below, the goal protein shape is a simple line. 
 
 
 .. image:: /Images/ProteinBuilder.gif
@@ -253,34 +360,62 @@ Protein Builder Code
 
   <problem>
       <p>The protein builder allows you string together the building blocks of proteins, amino acids, and see how that string will form into a structure. You are presented with a goal protein shape, and your task is to try to re-create it. In the example below, the shape that you are asked to form is a simple line.</p> 
+     <p>Be sure to click "Fold" to fold your protein before you click "Check".</p>
 
-      <script type="loncapa/python">
+  <script type="loncapa/python">
 
-  def two_d_grader(expect,ans):
+  def protex_grader(expect,ans):
     import json
     ans=json.loads(ans)
     if "ERROR" in ans["protex_answer"]:
-      raise ValueError("Protex did not understand your answer... try folding the protein")
+      raise ValueError("Protex did not understand your answer. Try folding the protein.")
     return ans["protex_answer"]=="CORRECT"
 
-
   </script>
+ 
     <text>
-      <customresponse cfn="two_d_grader">
+      <customresponse cfn="protex_grader">
         <designprotein2dinput width="855" height="500" target_shape="W;W;W;W;W;W;W"/>
       </customresponse>
     </text>
-    <p>Be sure to click "Fold" to fold your protein before you click "Check".</p>
     <solution>
       <p>
-              There are many protein sequences that will fold to the shape we asked you
-              about. Here is a sample sequence that will work. You can play around with
-              it if you are curious.
-          </p>
+        Many protein sequences, such as the following example, fold to a straight line.You can play around with the protein builder if you're curious.
+      </p>
       <ul>
         <li>
-                  Stick: RRRRRRR
-              </li>
+            Stick: RRRRRRR
+        </li>
       </ul>
     </solution>
   </problem>
+
+In this code:
+ 
+* **width** and **height** specify the dimensions of the application, in pixels.
+* **target_shape** lists the amino acids that, combined in the order specified, create the shape you've asked students to create. The list can only include the following letters, which correspond to the one-letter code for each amino acid. (This list appears in the upper-left corner of the protein builder.)
+
+  .. list-table::
+     :widths: 15 15 15 15
+     :header-rows: 0
+
+     * - A
+       - R
+       - N
+       - D
+     * - C
+       - Q
+       - E
+       - G
+     * - H
+       - I
+       - L
+       - K
+     * - M
+       - F
+       - P
+       - S
+     * - T
+       - W
+       - Y
+       - V